Rbm45^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAATATACAGACATGCAAA and ACTTGCTTACAACTACCAAC, which resulted in a 763 bp deletion beginning at Chromosome 2 position 76,378,345 bp and ending after 76,379,107 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000358265, ENSMUSE00000388560, and ENSMUSE00000345417 (exons 6, 7, and 8) and 294 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 286 and early truncation 5 amino acids later. (J:188991)