This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTATGGAAATACTAAGGGG and GCATTTCTGAAGCTTGGATA, which resulted in a 371 bp deletion beginning at Chromosome 3 position 101,897,863 bp and ending after 101,898,233 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000519337 (exon 3) and 184 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 100 and early truncation 22 amino acids later. (J:188991)