Ccdc166^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAAGGAGTGCTCTAACGAC and CCATTCTGTTGCTCTGGCAA, which resulted in a 2917 bp deletion beginning at Chromosome 15 position 75,979,638 bp and ending after 75,982,554 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001276403 and ENSMUSE00001220008 (exons 1 and 2) and 459 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. (J:188991)