Fam81b^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTGGGGAAATAATACAACT and TAGCCCACCACAGCATCACA, which resulted in a 316 bp deletion beginning at Chromosome 13 position 76,268,444 bp and ending after 76,268,759 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001378293 (exon 4) and 241 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 56 and early truncation 31 amino acids later. (J:188991)