This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTTTGGGACGCCCCAGCTG and GAGGGTCGATACTCTCCACA, which resulted in a 3327 bp deletion beginning at Chromosome 14 position 66,303,946 bp and ending after 66,307,272 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000123182, ENSMUSE00000123182, ENSMUSE00000123176 (exons 2, 3 and 4) and 2977 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 161 and early truncation 36 amino acids later. (J:188991)