This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGTCCTTAACCATGAGTGG and ATAGATATCAGCATCTAGGA, which resulted in a 5723 bp deletion beginning at Chromosome 12 position 74,296,535 bp and ending after 74,302,257 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001420864 (exon 1) and 382 bp of flanking intronic sequence including the splice acceptor and start site and is predicted to generate a null allele. (J:188991)