Efcab3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAGGATGCTAAGCTCTCCA and AAAACATCCAGAAGCTTTGG, which resulted in a 269 bp deletion beginning at Chromosome 11 position 104,693,210 bp and ending after 104,693,478 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000353657 (exon 4) and 154 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 63 and early truncation 5 amino acids later. (J:188991)