Urm1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTGCACTGGGCACAGTTTT and ACAATCAGAACCCCAGGACG, which resulted in a 212 bp deletion beginning at Chromosome 2 position 29,841,335 bp and ending after 29,841,546 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001234693 (exon 3) and 130 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 35 and early truncation 7 amino acids later. (J:188991)