Anapc7^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATATTAGGAGGTGTTTTGCG and AACTATGGTTAGATAGAGCA, which resulted in a 427 bp deletion beginning at Chromosome 5 position 122,432,528 bp and ending after 122,432,954 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000189114 (exon 5) and 315 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 136 and early truncation 6 amino acids later. (J:188991)