Trim69^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATTTGTGTGAAATTCCCCA and TTAGTTCTGTAGTTTGAGAG, which resulted in a 1495 bp deletion beginning at Chromosome 2 position 122,173,063 bp and ending after 122,174,557 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001284708, ENSMUSE00001259295 and ENSMUSE00001310986 (exons 4,5,6) and 1113 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 194 and early truncation 4 amino acids later. (J:188991)