Slc10a3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTCACTCCTTATAGTGCAG and GATGGCTGAATGACATTCAA, which resulted in a 2136 bp deletion beginning at Chromosome X position 74,368,986 bp and ending after 74,371,121 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000655036 (exon 3) and 341 bp of flanking intronic sequence including the splice acceptor, donor and start of translation and is predicted to generate a null allele. (J:188991)