This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTACAGACATTGGTGACCCA and AATTGACTTGATCAGCCCCA, which resulted in a 452 bp deletion beginning at Chromosome 15 position 75,918,943 bp and ending after 75,919,394 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000128499 (exon 2) and 387 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 31 and early truncation 10 amino acids later. There is a 2 bp insertion (AA) at the deletion site. (J:188991)