Zbtb34^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGGCACTAGATTCCCGCC and ACGTTTCGTGTCGGGAGAAA, which resulted in a 1469 bp deletion beginning at Chromosome 2 position 33,411,009 bp and ending after 33,412,477 bp (GRCm38/mm10) plus the insertion at the deletion site of a 61 bp sequence from ENSMUSE00000694537 (exon 3) in inverse orientation (GGGAATCTAGTGCCATCTCTGAGGCTGATGCATCACTTTCGAGTTTCTGTTCCACATACAT). This is predicted to cause a change of amino acid sequence after residue 17 and early truncation 2 amino acids later. (J:188991)