This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTGGAGGACCACTGTTGTG and ATTTAATGTGACTTCCGGGC, which resulted in a 1660 bp deletion beginning at Chromosome 5 position 30,957,801 bp and ending after 30,959,460 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000272694, ENSMUSE00001296365, ENSMUSE00000186434, ENSMUSE00001210652 and ENSMUSE00001228688 (exons 2, 3, 4, 5, and 6) and 869 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence and early truncation after residue 45. (J:188991)