This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTCTTAGTGCGGGTTAGGA and ACTAGCTTGTAGCTGGCACA, which resulted in a 170 bp deletion beginning at Chromosome 5 position 117,385,338 bp and ending after 117,385,507 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001296007 (exon 4) and 90 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 88 and early truncation 3 amino acids later. (J:188991)