Pxmp4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGAATCTCCAGTTCCCATG and GTACATCCGAGAAACCTGCC, which resulted in a 339 bp deletion beginning at Chromosome 2 position 154,592,079 bp and ending after 154,592,417 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000170074 (exon 3) and 140 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 58 and early truncation 5 amino acids later. (J:188991)