This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTGCAGAGAACAATGCCGG and CATCAAGCTACAGCCCTGGA, which resulted in a 404 bp deletion beginning at Chromosome 8 position 105,338,685 bp and ending after 105,339,088 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001204882 (exon 2) and 297 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 109 amino acids later. (J:188991)