Lysmd4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATTCTGTGTCAGTATCAGG and ACAGCATTAGAGTAGCTGAC, which resulted in a 5123 bp deletion beginning at Chromosome 7 position 67,223,456 bp and ending after 67,228,578 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000466123 and ENSMUSE00001380362 (exons 2 and 3) and 2247 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted generate a null allele. (J:188991)