Cped1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAAATCATCACACTCTTTAC and TTGGAACCACTGTATCTGTG, which resulted in a 260 bp deletion beginning at Chromosome 6 position 22,051,254 bp and ending after 22,051,513 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001312394 (exon 3) and 153 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 145 and early truncation 17 amino acids later. There is a 2 bp TT insertion at the deletion site. (J:188991)