U2af2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTAGGTCAACTAAGTTACG and ACTCTAGCTGGACTAAGTAC, which resulted in a 486 bp deletion beginning at Chromosome 7 position 5,070,084 bp and ending after 5,070,569 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000198884 (exon 7) and 347 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 201 and early truncation 5 amino acids later. (J:188991)