This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGAGCGATGCATCTGAGGA and GATTGGGCAGAATGAAACAT, which resulted in a 327 bp deletion beginning at Chromosome 2 position 36,052,858 bp and ending after 36,053,184 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000257467 (exon 2) and 179 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 16 and early truncation 33 amino acids later. (J:188991)