Cpd^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATGGGTTAAGAGATCAGCA and AATTACATATCACCCTTAGA, which resulted in a 483 bp deletion beginning at Chromosome 11 position 76,840,189 bp and ending after 76,840,671 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000294512 (exon 2) and 235 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 248 and early truncation 13 amino acids later. (J:188991)