This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTAGCTGCAAACTGTTAAA and GCTGAGTGCCAGCAGTATAG, which resulted in a 935 bp deletion beginning at Chromosome 8 position 109,721,125 bp and ending after 109,722,059 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000392117, ENSMUSE00000348960 (exons 6 and 7) and 861 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 55 and early truncation 20 amino acids later. (J:188991)