Actl6a^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TACTGTTCAGTGGATAACCC and ATATACTTCTTGAAGGAGAA, which resulted in a 345 bp deletion beginning at Chromosome 3 position 32,715,376 bp and ending after 32,715,720 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000171999 (exon 5) and 247 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 126 and early truncation 2 amino acids later. (J:188991)