This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATTAGCTCATTTTAAGCTG and TGTGGAATCGGCAGGATGGA, which resulted in a 914 bp deletion beginning at Chromosome 4 position 11,579,401 bp and ending after 11,580,314 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000243323 (exon 1) and 471 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to generate a null allele. (J:188991)