1700020N01Rik^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTTACAACACACTGCGGCA and GTAATCTAAGCTCGCTCCCG, which resulted in a 732 bp deletion beginning at Chromosome 10 position 21,593,062 bp and ending after 21,593,793 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000365479 and ENSMUSE00000335433 (exons 1 and 2) and 401 bp of flanking intronic sequence including the start site and splice donor and is predicted to generate a null allele. (J:188991)