Eight concatemerized fragments of a FoxA2 enhancer that contains a Gli binding site (GBS; TTATGACGGAGGCTAACAAGCAGGGAACACCCAAGTAGAAGCTGGCTGTC) and hsp68 minimal promoter drivie expression of an EGFP reporter gene. The transgene is flanked by two copies of the chicken beta-globin insulator. The pound symbol (#) is used when no line is specified and/or lines are pooled. (J:181293)