This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCTTGGTCTTGGGTCTTG and TCTTTGCAGTGTCGTGTTCA, which resulted in a 244 bp deletion beginning at Chromosome 18 position 14,679,354 bp and ending after 14,679,597 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000282373 (exon 2) and 167 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 23 and early truncation 18 amino acids later. (J:188991)