This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGAAAAAATACTCCTTACA and TTTGAAACTGATTAAGCTAA, which resulted in a 955 bp deletion beginning at Chromosome 11 position 99,219,039 bp and ending after 99,219,993 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261138, ENSMUSE00001305116 (exons 6 and 7) and 651 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 7 amino acids later. (J:188991)