This allele from project TCPR1412 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AAAGGGAGCTGCTTCTCCGG targeting the 5' side and GGGTTCTCATGATAGCTTAG targeting the 3' side of a critical region. This resulted in a 834-bp del Chr13: 8991436-8992269 with an insertion of 17-bp, TATCATGAGGGGTTCTC, at the repair junction (GRCm38). (J:265051)