Dpf3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAGCCTCGCCACAGCAGGA and GTTTTCCTGCTGGGAAAGCA, which resulted in a 342 bp deletion beginning at Chromosome 12 position 83,315,268 bp and ending after 83,315,609 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000275415 (exon 6) and 263 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 175 and early truncation 69 amino acids later. (J:188991)