Actl6b^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATACTAACTGACATGTGGGC and ACTAGTGCAGAAGGCCCCAT, which resulted in a 293 bp deletion beginning at Chromosome 5 position 137,563,060 bp and ending after 137,563,352 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001374145 (exon 5) and 195 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 123 and early truncation 24 amino acids later. (J:188991)