This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGACTGCATACGTTGTTCAG and CTGGTATGAGACATTAATGT, which resulted in a 1308 bp deletion beginning at Chromosome 9 position 86,573,848 bp and ending after 86,575,155 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000219614 (exon 3) and 382 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 17 amino acids later. There is an 8 bp (CGAGATAT) insertion at the deletion site. (J:188991)