This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAGAGCCATAACAGTGAGC and CTCACCAGGTTCCCATTCAG, which resulted in a 202 bp deletion beginning at Chromosome 15 position 74,762,378 bp and ending after 74,762,579 bp (GRCm38/mm10). This mutation deletes 202 bp from ENSMUSE00000394284 (exon 3) and is predicted to cause a change of amino acid sequence after residue 54 and termination 87 amino acids later. (J:188991)