H2-Eb2^b-em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGTTTTCTGGAGCAGTTGA and CAGAAATAACTATGACCTTG, which resulted in a 218 bp deletion beginning at Chromosome 17 position 34,333,301 bp and ending after 34,333,518 bp (GRCm38/mm10). This mutation deletes 218 bp of ENSMUSE00000411205 (exon 2) and is predicted to cause a change of amino acid sequence after residue 39 and early truncation 11 amino acids later. (J:188991)