This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGCTTGTTTTATTAGAAAG and TCTCTAATCAAGAGGTGTGG, which resulted in a 4285 bp deletion beginning at Chromosome 3 position 105,001,869 bp and ending after 105,006,153 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001357415 (exon 6) and 73 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 146 and early truncation 8 amino acids later. (J:188991)