This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTTTGACAAGTTTGCTCGG and GTGTAACTCCATAAGACGGC, which resulted in a 365 bp deletion beginning at Chromosome 3 position 29,993,409 bp and ending after 29,993,773 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001214312 (exon 4) and 151 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 16 and early truncation 29 amino acids later. (J:188991)