This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCCAGCCAGGTAAAGCGAG and AGGCAAGGCTGAAGTCTCCC, which resulted in a 921 bp deletion beginning at Chromosome 7 position 29,937,419 bp and ending after 29,938,339 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000965636 and ENSMUSE00000635760 (exons 3 and 4) and 698 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 19 amino acids later. (J:188991)