This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCATATAGCAAAAAGCCTGG and AATGTTAATATCTCTGTCAG, which resulted in a 405 bp deletion beginning at Chromosome 1 position 63,294,676 bp and ending after 63,295,080 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000154511 (exon 6) and 274 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 15 and early truncation 4 amino acids later. (J:188991)