This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTCTGGCTGGAACTTCCAG and TGAGATAGTGAAGCTATGGC, which resulted in a 396 bp deletion beginning at Chromosome 15 position 79,794,197 bp and ending after 79,794,592 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001205348 (exon 5) and 176 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 78 amino acids later. (J:188991)