This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGGCTGACAGCATGCTAG and GGATCAAGATGGCATTTCCA, which resulted in a 2382 bp deletion beginning at Chromosome 5 position 38,225,848 bp and ending after 38,228,229 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000546144 through ENSMUSE00001264135 (exons 3-5) and 2075 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 59 amino acids later. (J:188991)