This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAATCATGTCATTTCTAAG and CACCACAATTTAAGGCACAA, which resulted in a 348 bp deletion beginning at Chromosome 9 position 53,595,192 bp and ending after 53,595,539 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000276320 (exon 3) and 230 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 37 and early truncation 6 amino acids later. (J:188991)