Zfand3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCTTATTAGTTCAGTTGTC and TCTCCTTTGGATTTTGCATG, which resulted in a 313 bp deletion beginning at Chromosome 17 position 30,060,656 bp and ending after 30,060,968 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000548635 (exon 2) and 272 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 24 and early truncation 7 amino acids later. (J:188991)