This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTATGAGGAAGGCCTAGCCG and GCCATCCTCCCAGCAAATGA, which resulted in a 1813 bp deletion beginning at Chromosome 9 position 110,312,464 bp and ending after 110,314,276 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000220060 and ENSMUSE00000220064 (exons 3 and 4) and 1623 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 44 and early truncation 18 amino acids later. (J:188991)