Zbtb12^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGTTTCCCCAATTCCAAGG and TGCCAGGTAAGAGAACACGG, which resulted in a 2053 bp deletion beginning at Chromosome 17 position 34,895,103 bp and ending after 34,897,155 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000341344 (exon 2) and 406 bp of flanking intronic sequence including the start site and splice and is predicted to generate a null allele. (J:188991)