This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTATTCAGTGCCCTCAGTCA and AAGGATAGGTGGCAATAAAG, which resulted in a 953 bp deletion beginning at Chromosome 9 position 92,198,268 bp and ending after 92,198,820 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000997080 (exon 2) and 368 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 4 and early truncation 19 amino acids later. (J:188991)