Dennd6b^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTCAATGAGCAAAACCCGGA and TGATCCTGCAGACAACACAT, which resulted in a 571 bp deletion beginning at Chromosome 15 position 89,189,967 bp and ending after 89,190,537 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000380969 (exon 4) and 458 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 86 and early truncation 50 amino acids later. (J:188991)