Traf3ip1^em1(IMPC)Bay

This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 4 guide sequences AGCACAGCCCTGCCGCATTTGGG, TCTGGTCAGAGTGTGGTAGCTGG, AGATTATCTTGTTTGTTCCTTGG, TGATATGCACAGTATCTTGGTGG, which resulted in a 2.3 kb deletion that includes exons 6 and 7 and is predicted to result in a frameshift mutation and nonsense mediated decay. (J:265051, J:337482)