Pcsk6^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTACAGTCAGAGTGATCCT and TCACAGAGAGTCCAAGACAA, which resulted in a 309 bp deletion beginning at Chromosome 7 position 65,928,994 bp and ending after 65,929,302 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000199980 (exon 5) and 232 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 209 and early truncation 7 amino acids later. (J:188991)