This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGCGCAGACTTTCCTCAA and TGATTGCAAAGTTTTATGAT, which resulted in a 2265 bp deletion beginning at Chromosome 8 position 66,511,711 bp and ending after 66,513,975 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000151364 (exon 1) and 244 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to generate a null allele. (J:188991)